Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.186475 |
Chromosome: | chromosome 11 |
Location: | 3043795 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g478800 | (1 of 1) PTHR31027//PTHR31027:SF2 - FAMILY NOT NAMED // PROTEIN F18H3.4 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCATCCTTGGCTCTCATGGCACTGCTGC |
Internal bar code: | GGGCGACAAGAAGCAGGTCTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 750 |
LEAP-Seq percent confirming: | 99.6748 |
LEAP-Seq n confirming: | 2452 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCCTCCTTCGACTCCTCCT |
Suggested primer 2: | GAGATATGTGCAGGGGCATT |