Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.186481 |
Chromosome: | chromosome 1 |
Location: | 5906226 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g042050 | MSRB3 | Methionine sulphoxide reductase; (1 of 3) K07305 - peptide-methionine (R)-S-oxide reductase (msrB) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGACCTCGGTGCGCGGCATAAAGATGATGC |
Internal bar code: | ACATGTCCGAACGAGCAGGGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 452 |
LEAP-Seq percent confirming: | 97.5684 |
LEAP-Seq n confirming: | 321 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAATCGCACATTGTGTACC |
Suggested primer 2: | AACAGGAATACGTTGCGGTC |