| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.186683 |
| Chromosome: | chromosome 8 |
| Location: | 4661475 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g383600 | SRR21 | Scavenger receptor cysteine rich (SRCR) protein; (1 of 1) IPR001190//IPR017448//IPR029062 - SRCR domain // SRCR-like domain // Class I glutamine amidotransferase-like | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCTTTCGCTGCATGTGCCACGCGCTTCT |
| Internal bar code: | TATCGTGGAGAATGTTAGGTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 446 |
| LEAP-Seq percent confirming: | 98.0132 |
| LEAP-Seq n confirming: | 148 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGAGCACGCTCATGTTAGG |
| Suggested primer 2: | GGCAAAACACTTGCTCGAAT |