Insertion junction: LMJ.RY0402.186683_4

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.186683
Chromosome:chromosome_12
Location:1214842
Confidence (%):58
Locus systematic id Locus common name Defline Orientation Feature
Cre12.g489500 antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):TGACACTACTTGATGACGGCCGTGTCAGGA
Internal bar code:ACTTTTGCGAGGTGTGTGGGGC

Confirmation - LEAP-Seq

LEAP-Seq distance:378
LEAP-Seq percent confirming:75.7215
LEAP-Seq n confirming:1653
LEAP-Seq n nonconfirming:530
LEAP-Seq n unique pos:10

Suggested primers for confirmation by PCR

Suggested primer 1:CGTTGGACTCATCGCTAACA
Suggested primer 2:CATACCGGAGCAAGGATGAT