| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.186771 |
| Chromosome: | chromosome 2 |
| Location: | 1956686 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g088000 | POC17,PHB1 | Proteome of centriole protein 17; (1 of 1) K17081 - prohibitin 2 (PHB2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTTTGAGGAGAGGCTGTAGTGAATGGCCT |
| Internal bar code: | GGGTGGGCCGATCGTAGGGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 103 |
| LEAP-Seq percent confirming: | 99.5995 |
| LEAP-Seq n confirming: | 746 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTTCGTGCGCTCAGATAAG |
| Suggested primer 2: | GACCCGTGTCAATCAGTCCT |