| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.186817 |
| Chromosome: | chromosome 9 |
| Location: | 3233188 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g387689 | FAP76,CCDC180 | Flagellar Associated Protein 76; (1 of 1) PTHR21444//PTHR21444:SF14 - FAMILY NOT NAMED // COILED-COIL DOMAIN-CONTAINING PROTEIN 180 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGAGACCCCGCGAGGGTAGCCCACCCCAG |
| Internal bar code: | CCGCGCAGATTGAGTCGCCTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 276 |
| LEAP-Seq percent confirming: | 99.7573 |
| LEAP-Seq n confirming: | 822 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAACCTGCACACGTCCCTT |
| Suggested primer 2: | GAATAAACTGCCCCACTCCA |