Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.186856 |
Chromosome: | chromosome 4 |
Location: | 3592718 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g228550 | (1 of 2) PTHR31140//PTHR31140:SF1 - FAMILY NOT NAMED // B3 DOMAIN-CONTAINING TRANSCRIPTION FACTOR ABI3 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGAAGTATGAGGTTGGGGAGGGAGGAGGG |
Internal bar code: | GGTCCGCTGGCCTCTAGGTTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 542 |
LEAP-Seq percent confirming: | 99.7783 |
LEAP-Seq n confirming: | 900 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGCTGAGCCGCTGTAAATA |
Suggested primer 2: | TACCAGATCCGCTGCTTCTT |