Insertion junction: LMJ.RY0402.186869_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.186869
Chromosome:chromosome_1
Location:3389171
Confidence (%):58
Locus disrupted Locus common name Defline Orientation Feature
Cre01.g021550 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GCGCCGCGCACGGGCACGGACCCCGCGCTG
Internal bar code:CGCCTCCTGATTACCTTAAAAG

Confirmation - LEAP-Seq

LEAP-Seq distance:456
LEAP-Seq percent confirming:100.0
LEAP-Seq n confirming:43
LEAP-Seq n nonconfirming:0
LEAP-Seq n unique pos:7

Suggested primers for confirmation by PCR

Suggested primer 1:GACAGCAGCGACGACTACAA
Suggested primer 2:GACCTACCTCAGGCAAGCAG