Insertion junction: LMJ.RY0402.186869_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.186869
Chromosome:chromosome_6
Location:1732171
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g261750 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GCATAACAGAGGCTGCAACCGGTGGGCGGG
Internal bar code:GGCAGGCCCGGCCGCGTGTATT

Confirmation - LEAP-Seq

LEAP-Seq distance:290
LEAP-Seq percent confirming:93.5528
LEAP-Seq n confirming:2728
LEAP-Seq n nonconfirming:188
LEAP-Seq n unique pos:3

Suggested primers for confirmation by PCR

Suggested primer 1:AGCGAGGGATAATGATCGTG
Suggested primer 2:GACGGAAGTTGAAGAGACGC