| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.187030 |
| Chromosome: | chromosome 2 |
| Location: | 6809905 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g118900 | MYG1 | MYG1/GAMM1-like protein; (1 of 1) PF03690 - Uncharacterised protein family (UPF0160) (UPF0160) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGATGCGTGACCATGCGGGTCTATGCAGG |
| Internal bar code: | GGACACTCTGGGGGGTGTCGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 493 |
| LEAP-Seq percent confirming: | 73.7048 |
| LEAP-Seq n confirming: | 754 |
| LEAP-Seq n nonconfirming: | 269 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCCCAGCTAATACCGTACA |
| Suggested primer 2: | TTATGGCTGAAGGAGCCTGT |