| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.187031 |
| Chromosome: | chromosome 10 |
| Location: | 3015891 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g441050 | (1 of 2) PTHR12321:SF55 - PHD FINGER PROTEIN ALFIN-LIKE 4 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCGTCACAACCTGCCAGCTACCGTCGGT |
| Internal bar code: | AAATCGACATGGGCGGGGTATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 826 |
| LEAP-Seq percent confirming: | 99.7988 |
| LEAP-Seq n confirming: | 1984 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACAATGCCTCGGAAACAAC |
| Suggested primer 2: | ATTTCGACGGACGGTTACTG |