| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.187050 |
| Chromosome: | chromosome 10 |
| Location: | 15006 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g417500 | CYN20E,CYN20-5,CYN9 | (1 of 1) PF00160//PF04969 - Cyclophilin type peptidyl-prolyl cis-trans isomerase/CLD (Pro_isomerase) // CS domain (CS); Cyclophilin 20-5 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTATCTGCAGGAACAAACGGGAGCCAGTTC |
| Internal bar code: | ATGGGTCCTCGCGAATCACCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 110 |
| LEAP-Seq percent confirming: | 87.5 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAAATCTGCTGTGCCACTA |
| Suggested primer 2: | CACATATGGTTGCCCCCTAC |