| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.187094 |
| Chromosome: | chromosome 4 |
| Location: | 2673679 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g223150 | NCL1,CLR18,OPR20 | (1 of 1) IPR008920 - Transcription regulator FadR/GntR, C-terminal; Nuclear Control of chloroplast Like 1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGTCCGCGTGTAGCAGGCCACGGATGGGC |
| Internal bar code: | CGCGAATGTCTTACGAACTGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 486 |
| LEAP-Seq percent confirming: | 78.8177 |
| LEAP-Seq n confirming: | 1280 |
| LEAP-Seq n nonconfirming: | 344 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACGAGTGAGTGAAGGGGTG |
| Suggested primer 2: | TTGACCGAAGCCCATATCTC |