| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.187240 |
| Chromosome: | chromosome 16 |
| Location: | 5158286 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g683450 | AGP2 | (1 of 4) 2.7.7.27 - Glucose-1-phosphate adenylyltransferase / ADP-glucose synthase; ADP-glucose pyrophosphorylase large subunit | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACAGTGTATGCGATACAGCAACGGGCTGT |
| Internal bar code: | TTAGTCAAAAAGTCTGTCATTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 280 |
| LEAP-Seq percent confirming: | 81.8153 |
| LEAP-Seq n confirming: | 2614 |
| LEAP-Seq n nonconfirming: | 581 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGACACGAGCTGAGGGTGT |
| Suggested primer 2: | CTTTTACGCCGCCAATATGT |