Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.187286 |
Chromosome: | chromosome 12 |
Location: | 9372374 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g540350 | RCD2 | Rcd1-like protein; (1 of 2) K12606 - CCR4-NOT transcription complex subunit 9 (RCD1, CNOT9, CAF40) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATCGGCAACCCTGCCAGCCCTGCCGCCTC |
Internal bar code: | GACCGCGGCGAGTCACCACGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 241 |
LEAP-Seq percent confirming: | 98.7131 |
LEAP-Seq n confirming: | 1841 |
LEAP-Seq n nonconfirming: | 24 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATACCGTGTGGCGATAAAGC |
Suggested primer 2: | AGGCAGCACATACACAGTGC |