| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.187297 |
| Chromosome: | chromosome 6 |
| Location: | 3481158 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278098 | MCCA,MCC1 | Methylcrotonoyl-CoA carboxylase alpha subunit; (1 of 2) 6.4.1.4 - Methylcrotonoyl-CoA carboxylase / Methylcrotonyl-CoA carboxylase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAAGTACAAGTATCGTGTTGCGTGCGCA |
| Internal bar code: | ATTTATTTAGGCCTGGAGGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 518 |
| LEAP-Seq percent confirming: | 80.2582 |
| LEAP-Seq n confirming: | 1057 |
| LEAP-Seq n nonconfirming: | 260 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCAGCACTCTCCATTGTTA |
| Suggested primer 2: | GGAATTGGAAAATGGGGAGT |