| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.187327 |
| Chromosome: | chromosome 9 |
| Location: | 1784960 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g396250 | VTE5 | Phosphatidate cytidylyltransferase; (1 of 1) K18678 - phytol kinase (VTE5) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGCATCGCCGCGCGGGAGTTTGCTGAGG |
| Internal bar code: | AGAAGGGGCGGCACGACGAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 562 |
| LEAP-Seq percent confirming: | 87.5458 |
| LEAP-Seq n confirming: | 239 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGACATGGACGTAATGTTGC |
| Suggested primer 2: | CCGACACACACAAACTCACC |