| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.187370 |
| Chromosome: | chromosome 3 |
| Location: | 7982516 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g201850 | SRH10 | (1 of 2) K10877 - DNA repair and recombination protein RAD54B (RAD54B); SNF2-related DNA/RNA helicase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACCACCTACCACCTACCGCCAGGCGGCCC |
| Internal bar code: | CCTACTGGGCTCGCCGATGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 119 |
| LEAP-Seq percent confirming: | 98.0583 |
| LEAP-Seq n confirming: | 101 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGATGGGCTACCAGACGTT |
| Suggested primer 2: | ACCGTACTGAATGGCGAAAC |