| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.187537 |
| Chromosome: | chromosome 6 |
| Location: | 3651188 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278131 | (1 of 1) IPR000104//IPR002083//IPR008974 - Antifreeze protein, type I // MATH/TRAF domain // TRAF-like | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGAAATCCCTTCCTGGTCAGAAAGCAAG |
| Internal bar code: | GTTGACTAGGGGTCGTGTGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 111 |
| LEAP-Seq percent confirming: | 99.4379 |
| LEAP-Seq n confirming: | 1769 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTGCTTAGGCCAAGTCCCT |
| Suggested primer 2: | TGATCAGGATCAAGTGGTGG |