| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.187611 |
| Chromosome: | chromosome 3 |
| Location: | 1026705 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g148450 | TEH1 | Acetyl-CoA thioesterase/hydrolase; (1 of 1) 3.1.2.1 - Acetyl-CoA hydrolase / Acetyl-CoA deacylase | 3'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTCGAGACAATCTTCTCGGAACACCCTT |
| Internal bar code: | ACGCGGATGGGGTCCGGTGAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 147 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 210 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGCTAGCTTCGGGACTTTC |
| Suggested primer 2: | ATTACGATACGTTGAGCCCG |