| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.187620 |
| Chromosome: | chromosome 17 |
| Location: | 7074843 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g746997 | ADHE,ADHE1,ADH1 | Dual function alcohol/acetaldehyde dehydrogenase; (1 of 2) 1.2.1.10 - Acetaldehyde dehydrogenase (acetylating) / Aldehyde dehydrogenase (acylating) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGATGGCGGTGGAGGTGGGGTTGGTGGT |
| Internal bar code: | AACGCTGTAAAGGTAAGAGATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 728 |
| LEAP-Seq percent confirming: | 99.4413 |
| LEAP-Seq n confirming: | 534 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTATATGTCCACTCGCCGCT |
| Suggested primer 2: | CCATCTCCATCTCTTCCCAA |