| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.187843 |
| Chromosome: | chromosome 8 |
| Location: | 3704638 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g376800 | MIF2 | Mitochondrial translation initiation factor 2; (1 of 1) PTHR23115//PTHR23115:SF184 - TRANSLATION FACTOR // TRANSLATION INITIATION FACTOR IF-2, MITOCHONDRIAL | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTACCACTGTTCCTGGCTCCGCCCTCACTT |
| Internal bar code: | GGTCGTGTATGCCGTATGGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 465 |
| LEAP-Seq percent confirming: | 99.7642 |
| LEAP-Seq n confirming: | 1269 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGTGTAGATACCAGCCCAA |
| Suggested primer 2: | AGTGTAGCGAAAGGGGGTTT |