Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.187843 |
Chromosome: | chromosome 8 |
Location: | 3704638 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g376800 | MIF2 | Mitochondrial translation initiation factor 2; (1 of 1) PTHR23115//PTHR23115:SF184 - TRANSLATION FACTOR // TRANSLATION INITIATION FACTOR IF-2, MITOCHONDRIAL | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTACCACTGTTCCTGGCTCCGCCCTCACTT |
Internal bar code: | GGTCGTGTATGCCGTATGGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 465 |
LEAP-Seq percent confirming: | 99.7642 |
LEAP-Seq n confirming: | 1269 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGTGTAGATACCAGCCCAA |
Suggested primer 2: | AGTGTAGCGAAAGGGGGTTT |