Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.187860 |
Chromosome: | chromosome 12 |
Location: | 5200726 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g527800 | DNAL4,LC10,ODA-LC10,DLC10,DLL3,MOT24 | Outer Arm Dynein Light Chain; (1 of 1) K10412 - dynein light chain 4, axonemal (DNAL4) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTGTAACGTCCTTGACTCCGTCGCACGGA |
Internal bar code: | GAATGGTGAGACTCAGAAGACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1032 |
LEAP-Seq percent confirming: | 99.7044 |
LEAP-Seq n confirming: | 1012 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGCACAGTATGCCCGTACC |
Suggested primer 2: | TGCACGTTGAGATGAAGGAG |