| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.187882 |
| Chromosome: | chromosome 12 |
| Location: | 3655462 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g514250 | HLM17 | (1 of 1) PF08429 - PLU-1-like protein (PLU-1); Histone-lysine N-methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGCGGGGGGACAGAGGTGTGTGTATTA |
| Internal bar code: | CTTGCGCCTGTAGCGATTCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 270 |
| LEAP-Seq percent confirming: | 98.9899 |
| LEAP-Seq n confirming: | 294 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCATCTCTACACTTCCCCA |
| Suggested primer 2: | CTTGGACCTTAAGGGTGGCT |