| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.188001 |
| Chromosome: | chromosome 6 |
| Location: | 1955482 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g263800 | SEE2 | Putative splicing endonuclease positive effector; (1 of 1) PTHR10887:SF369 - DNA2/NAM7 HELICASE FAMILY PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACCGCTCCCCTCTCCTCCCCCACACCAGA |
| Internal bar code: | TGTTCTGGGTATCACACGTCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 158 |
| LEAP-Seq percent confirming: | 56.1835 |
| LEAP-Seq n confirming: | 2008 |
| LEAP-Seq n nonconfirming: | 1566 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGGCAATATCACACCTGC |
| Suggested primer 2: | GCAGCAAGCGATAAGGGTAG |