| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.188055 |
| Chromosome: | chromosome 12 |
| Location: | 1914201 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g510900 | HSLU1,HUV1,CLPY1 | ATP-dependent subunit of the HslUV protease; (1 of 2) K03667 - ATP-dependent HslUV protease ATP-binding subunit HslU (hslU) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTTGACAGCACATAACTCAGCAAACGGC |
| Internal bar code: | AGGCACGCGAGCTTGGGGCTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 714 |
| LEAP-Seq percent confirming: | 88.0449 |
| LEAP-Seq n confirming: | 7615 |
| LEAP-Seq n nonconfirming: | 1034 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGGCGGAGGTGTGGTTTAC |
| Suggested primer 2: | ACAAGATGTACCGGCTCAGG |