| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.188056 |
| Chromosome: | chromosome 10 |
| Location: | 1697769 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g430250 | ELG21 | Exostosin-like glycosyltransferase 21; (1 of 2) IPR000742//IPR004263//IPR013111 - EGF-like domain // Exostosin-like // EGF-like domain, extracellular | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCATGGATTCCCAAGCTGCACACCCACAC |
| Internal bar code: | ATGCTCCCCACCGTCGGGAGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 497 |
| LEAP-Seq percent confirming: | 99.03 |
| LEAP-Seq n confirming: | 1123 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCTAGTCAGGAAGCGTGTC |
| Suggested primer 2: | AGGGAGGTAAGGCATCAGGT |