| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.188149 |
| Chromosome: | chromosome 3 |
| Location: | 3140782 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g165050 | PMA4 | (1 of 3) K01535 - H+-transporting ATPase (E3.6.3.6); Plasma membrane P-type calcium ATPase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCACAAGTGGGGCATAGGCAGCATGCCC |
| Internal bar code: | GGGTCCCATGTCAGTTCTCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 359 |
| LEAP-Seq percent confirming: | 99.8064 |
| LEAP-Seq n confirming: | 3093 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCAGCACTTTGAGAAGGTC |
| Suggested primer 2: | CTGATGCTCATCACGCTGTT |