Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.188232 |
Chromosome: | chromosome 11 |
Location: | 1443390 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467730 | (1 of 68) 2.1.1.43 - Histone-lysine N-methyltransferase / Protein-lysine N-methyltransferase | CDS|outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCGTCCAGCTCGGTTTTCTGCTCGCTG |
Internal bar code: | TCATTACGTGCGCAAGGCCAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 359 |
LEAP-Seq percent confirming: | 98.4876 |
LEAP-Seq n confirming: | 2735 |
LEAP-Seq n nonconfirming: | 42 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAGCACTTCCAAGCGTTCCT |
Suggested primer 2: | GTTCAAGGAAGGCAGTCAGC |