Insertion junction: LMJ.RY0402.188283_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.188283
Chromosome:chromosome_12
Location:1846372
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre12.g511750 antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):TGGTACTGTTGATCCCCGCTCTCGCGCAGC
Internal bar code:GCAGCGCGGGGGACTCGGCGCG

Confirmation - LEAP-Seq

LEAP-Seq distance:330
LEAP-Seq percent confirming:84.375
LEAP-Seq n confirming:54
LEAP-Seq n nonconfirming:10
LEAP-Seq n unique pos:4

Suggested primers for confirmation by PCR

Suggested primer 1:GCTGTCCAAGCTGCATACAA
Suggested primer 2:ATGGTGTTTGCTGTGTGGAA