| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.188345 |
| Chromosome: | chromosome 7 |
| Location: | 664702 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g317250 | CHI5 | (1 of 2) K01183 - chitinase (E3.2.1.14); Chitinase-like hydrolase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGCACTGGCTCACCCGCGCGGACACAGT |
| Internal bar code: | AATGGGCCCTTACAGCTTGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1130 |
| LEAP-Seq percent confirming: | 85.0068 |
| LEAP-Seq n confirming: | 3742 |
| LEAP-Seq n nonconfirming: | 660 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTGTCAAGGTTGGAGGTC |
| Suggested primer 2: | TTTCCCTACCCTCGTCATTG |