| Insertion cassette: | CIB1 | 
| Side of cassette: | 3' | 
| Strand: | - | 
| Strain: | LMJ.RY0402.188458 | 
| Chromosome: | chromosome 17 | 
| Location: | 6918942 | 
| Confidence (%): | 95 | 
| Locus systematic id | Locus common name | Defline | Feature | 
|---|---|---|---|
| Cre17.g745947 | (1 of 71) IPR016181 - Acyl-CoA N-acyltransferase | 3'UTR | 
| Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGGTGTGAAGGCGCTCTCGCCAGTCCAA | 
| Internal bar code: | AAGCAGTGGTAGGTAGGAAAGA | 
| Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1011 | 
| LEAP-Seq percent confirming: | 99.8467 | 
| LEAP-Seq n confirming: | 3257 | 
| LEAP-Seq n nonconfirming: | 5 | 
| LEAP-Seq n unique pos: | 20 | 
| Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCTGGAGATTCAGGGGATG | 
| Suggested primer 2: | AGCCAAACAATAGACACCCG |