Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.188483 |
Chromosome: | chromosome 6 |
Location: | 3544868 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g278111 | (1 of 6) IPR000595//IPR005821//IPR018490 - Cyclic nucleotide-binding domain // Ion transport domain // Cyclic nucleotide-binding-like | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCGCACCCAACCCAGTTTGTTGAGCTCG |
Internal bar code: | TACTTGGGGCTGAAACGGGTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 679 |
LEAP-Seq percent confirming: | 96.8176 |
LEAP-Seq n confirming: | 1582 |
LEAP-Seq n nonconfirming: | 52 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGCAGCGGAAACATAGTCT |
Suggested primer 2: | GGGTTGTCCTAATTCGGGTT |