Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.188529 |
Chromosome: | chromosome 12 |
Location: | 9027539 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g543400 | FDH1,GSNOR1 | Nitrosoglutathione (GSNO) reductase 1; (1 of 2) 1.1.1.284 - S-(hydroxymethyl)glutathione dehydrogenase / NAD-linked formaldehyde dehydrogenase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGTGTTTACGCTGTGTGCGATATGTTTA |
Internal bar code: | GCGCGCGCAATGAAGAATGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 714 |
LEAP-Seq percent confirming: | 99.8415 |
LEAP-Seq n confirming: | 1890 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTCCATCTCACTGTGCAGC |
Suggested primer 2: | ACAGATTGCTACACCCGGTC |