| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.188543 |
| Chromosome: | chromosome 2 |
| Location: | 5481500 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g108050 | (1 of 1) IPR008417 - B-cell receptor-associated protein 29/31 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGCTCCGCGGCCGCGCAGCCTGTGTCCA |
| Internal bar code: | GTACCGGACTCGATGGAGAGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 982 |
| LEAP-Seq percent confirming: | 99.7788 |
| LEAP-Seq n confirming: | 3158 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGAAGCAAAAGGCAGTGGA |
| Suggested primer 2: | CCACCTGTAGCTGCTCCTTC |