| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.188544 |
| Chromosome: | chromosome 2 |
| Location: | 5834781 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g111050 | AMT7,AMT1G | Ammonium transporter; (1 of 8) K03320 - ammonium transporter, Amt family (amt, AMT, MEP) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCATCGGACTTCGTGTTGTTGAATGGGTG |
| Internal bar code: | GGGGTAGCGATGACTTTGTCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 917 |
| LEAP-Seq percent confirming: | 99.2506 |
| LEAP-Seq n confirming: | 4768 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGGTTTGGGGCATTCAGTC |
| Suggested primer 2: | GCCTGCCAACTAAGATAGCG |