Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.188585 |
Chromosome: | chromosome 2 |
Location: | 5042010 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g104500 | CDJ4 | (1 of 2) IPR001080 - 3Fe-4S ferredoxin; Chloroplast DnaJ-like protein 4 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTACACCATTCTCGGCGTGGTGCGTCCT |
Internal bar code: | TTCTGAGCATGTCTGTATCGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1082 |
LEAP-Seq percent confirming: | 99.6975 |
LEAP-Seq n confirming: | 1648 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGAGTCCTCGATCTCAAACG |
Suggested primer 2: | TGCATCACGTGTGGTGTATG |