| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.188610 |
| Chromosome: | chromosome 7 |
| Location: | 4124383 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g342850 | ODA5,DCC3 | (1 of 2) PTHR21694//PTHR21694:SF18 - UNCHARACTERIZED // COILED-COIL DOMAIN-CONTAINING PROTEIN 114; Outer Arm Dynein assembly protein 5 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGACTGGGCCCTACGGTTATCAAATATGT |
| Internal bar code: | CCAAGCGATGCCTCGTGCGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 982 |
| LEAP-Seq percent confirming: | 99.7143 |
| LEAP-Seq n confirming: | 2443 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGACGTGGGTTGTCAACTG |
| Suggested primer 2: | GACACGAATACACACACGCC |