| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.188632 |
| Chromosome: | chromosome 1 |
| Location: | 3393218 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g021600 | HEL1 | (1 of 1) PTHR24031//PTHR24031:SF255//PTHR24031:SF274 - RNA HELICASE // DEAD-BOX ATP-DEPENDENT RNA HELICASE 40 // SUBFAMILY NOT NAMED; DEAD-box RNA helicase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGTGCTTGCTGACTGTTACTTGGCAGTGG |
| Internal bar code: | CAGCGACGGGCCTGGGGCTTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1011 |
| LEAP-Seq percent confirming: | 98.1667 |
| LEAP-Seq n confirming: | 2838 |
| LEAP-Seq n nonconfirming: | 53 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGACTACATCCACCGCATC |
| Suggested primer 2: | AGGCTGACAGTTAGGGCTGA |