Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.188700 |
Chromosome: | chromosome 12 |
Location: | 1524756 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g487101 | CSV9 | Chlamydomonas-specific family protein; (1 of 781) IPR000104 - Antifreeze protein, type I | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGGCTGGGTTGCACTCTCCCTTGACGCT |
Internal bar code: | CAAGTGGGTAACTCATGAACGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 918 |
LEAP-Seq percent confirming: | 93.5484 |
LEAP-Seq n confirming: | 174 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCACTGTGTCTCCATTGCTG |
Suggested primer 2: | GGTACTGTCATTGGGAGCGT |