| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.188764 |
| Chromosome: | chromosome 1 |
| Location: | 5059114 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g034950 | (1 of 1) K06184 - ATP-binding cassette, subfamily F, member 1 (ABCF1); Soluble ABC-F domain containing protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGACCGTTCCCGAGCGCTAACAATACCGA |
| Internal bar code: | TGGGGCCGGCACCATATAGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 324 |
| LEAP-Seq percent confirming: | 99.3464 |
| LEAP-Seq n confirming: | 456 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCATGCCTGCATAATGAAA |
| Suggested primer 2: | CTCGAGGGCTTGTCACTCTC |