Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.188794 |
Chromosome: | chromosome 17 |
Location: | 3302785 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g723250 | CPP1,CPE1 | chloroplast processing enzyme; (1 of 1) PTHR11851//PTHR11851:SF152 - METALLOPROTEASE // PROTEIN UCR-2.3 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAACTGGCGCCGGTTATTGCAAGTTTGTA |
Internal bar code: | GCAGACACTCGGTGACTGTGCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 917 |
LEAP-Seq percent confirming: | 99.1013 |
LEAP-Seq n confirming: | 8050 |
LEAP-Seq n nonconfirming: | 73 |
LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGTATCCCCACCCCTACAA |
Suggested primer 2: | TTTGTGCGCTGTTGGTAAAG |