| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.188794 |
| Chromosome: | chromosome 17 |
| Location: | 3302791 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g723250 | CPP1,CPE1 | chloroplast processing enzyme; (1 of 1) PTHR11851//PTHR11851:SF152 - METALLOPROTEASE // PROTEIN UCR-2.3 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGTCTGCAAAGAACACTGTGCACGCACG |
| Internal bar code: | TATCAGAAGGGCATGACTACCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 576 |
| LEAP-Seq percent confirming: | 86.5568 |
| LEAP-Seq n confirming: | 1365 |
| LEAP-Seq n nonconfirming: | 212 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGTATCCCCACCCCTACAA |
| Suggested primer 2: | TTTGTGCGCTGTTGGTAAAG |