Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.188833 |
Chromosome: | chromosome 10 |
Location: | 830497 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g423550 | ATA2 | threonine aldolase; (1 of 1) 4.1.2.49 - L-allo-threonine aldolase | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCCGCGCTGAAACGGGGCCTACACTTT |
Internal bar code: | GGTCCGAATGAAAGATTCGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 695 |
LEAP-Seq percent confirming: | 98.2989 |
LEAP-Seq n confirming: | 2947 |
LEAP-Seq n nonconfirming: | 51 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCGTACGCCACCACTCTAC |
Suggested primer 2: | CTTCGACTCAACCAGGAAGC |