Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.188997 |
Chromosome: | chromosome 7 |
Location: | 638291 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g316992 | (1 of 3) K14802 - phospholipid-transporting ATPase [EC:3.6.3.1] (DRS2, ATP8A) | 3'UTR|outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCACCCACTCAGACATGCAGGACCCCCTC |
Internal bar code: | TGACTTGTGTCATAAGAATGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 428 |
LEAP-Seq percent confirming: | 99.776 |
LEAP-Seq n confirming: | 4900 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGCAGAAGCACGCAATACT |
Suggested primer 2: | GGCGTTTGTCCAGAAAACAT |