| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.189026 |
| Chromosome: | chromosome 2 |
| Location: | 204331 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g074600 | DeSI-2,CGL60,DESI2 | (1 of 6) PF05903 - PPPDE putative peptidase domain (Peptidase_C97); DeSI-type SUMO protease | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCAAGACCCGGCAGACCCGGTTTGACGAG |
| Internal bar code: | ATTCACGAATGCGCGTTATTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 665 |
| LEAP-Seq percent confirming: | 82.3529 |
| LEAP-Seq n confirming: | 28 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGAATGCTCTCTTGCACC |
| Suggested primer 2: | CCTACCTGGTGCTCCACATT |