Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.189049 |
Chromosome: | chromosome 16 |
Location: | 6920742 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g676757 | PTB8 | (1 of 9) K14640 - solute carrier family 20 (sodium-dependent phosphate transporter) (SLC20A, PIT); Sodium/phosphate symporter | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGACTGCGAGCACAGAAACAGCGTAACC |
Internal bar code: | GCGCGAGAGGTGTGGATGCGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1106 |
LEAP-Seq percent confirming: | 99.9606 |
LEAP-Seq n confirming: | 2537 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGATGAACGCCTAACGGTAT |
Suggested primer 2: | AAGATGAGAGATAGCGGGCA |