| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.189059 |
| Chromosome: | chromosome 12 |
| Location: | 5138684 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g527100 | (1 of 1) IPR002048//IPR003439//IPR003593//IPR027417 - EF-hand domain // ABC transporter-like // AAA+ ATPase domain // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCGCGCGTATCCCCATCCCACAGTACGA |
| Internal bar code: | CTCCGTCAAGGAGTGACCGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 427 |
| LEAP-Seq percent confirming: | 98.8018 |
| LEAP-Seq n confirming: | 2886 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGGTGTGTAGGATTGTGTG |
| Suggested primer 2: | CAGTTGAGTGGGTCGTGTTG |