| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.189071 |
| Chromosome: | chromosome 15 |
| Location: | 501690 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g636800 | GST12 | (1 of 15) 2.5.1.18 - Glutathione transferase / S-(hydroxyalkyl)glutathione lyase; Glutathione S-transferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTCGCCATACCCCCACGTCCAGGCCTAC |
| Internal bar code: | CCTATAAGAAATCTGTCCCAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 188 |
| LEAP-Seq percent confirming: | 99.1784 |
| LEAP-Seq n confirming: | 1690 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCAGTGGCAGTAGCCTCAT |
| Suggested primer 2: | CGTGGAGGAGGTGTGTTTTT |