Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.189117 |
Chromosome: | chromosome 1 |
Location: | 877893 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g004600 | RWP12 | (1 of 16) PF02042 - RWP-RK domain (RWP-RK); RWP-RK transcription factor | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTCGCAATCGCCGCCGCCTGGTGCTGCTG |
Internal bar code: | TAGAACTCTGGGGCTTGCTGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 361 |
LEAP-Seq percent confirming: | 78.9174 |
LEAP-Seq n confirming: | 277 |
LEAP-Seq n nonconfirming: | 74 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTAGGCGGCGTAGTTCATTC |
Suggested primer 2: | GTACCCGCCAATGTACCAAC |